DNA meets Music !!!!!

diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Jo poste das mal hier rein ... wenns interessiert ...

Um mal wieder etwas wissenschaftliches ins Forum zu bringen :)


Wie viele wissen sollten, sind die Grund Bausteine des Lebens 4 Basen (Adenin, Guanin, Cytosin bzw. Thymin -> sind chemische Verbindungen )
Die Abkürzung lautet A,G,T,C

Diese 4 Basen codieren das ganze Leben in einem DNA Strang ...
sprich die Aneinanderreihung dieser 4 Basen ergibt den genetischen Code der alle Informationen (ALLE) in sich trägt.
Wie wir ausschaun , wie wir denken , Hautzellen , wo soll sich die Leber im Körper, wie groß wird das herz usw...
Jegliche Information ist eben in so einem DNA Strang codiert....egal ob Urwaldkäfer, Delfine, Viren , Bakterien oder Mensch !

AGCCTGACTGTACGTAAAGC -> könnte ein Auschnitt sein aus einer DNA

dieser Code könnte z.B ein Protein codieren welches z.B wichtig wäre für die Blutregulierung usw..

Daher war es ja wichtig das Menschliche Genom (Das komplette Gen, einfach ausgedrückt) sprich den ganzen Code zu bekommen...
Dies wurde ja bekanntlich geschaft ! (Zur Zeit werden Genome aus den Lebewesen der Meere untersucht)
Somit ist man in der Lage Krankheiten zu identifizieren bzw. auch zu heilen.

Vom Menschen weiß man es ja mitlerweile (den Code) allerdings hat man das Genom noch nicht vollständig decodiert, sprich man weiß nicht von allen Sequenzen (Abschnitte auf DNA ) welche Funktion sie haben.

Es gibt kein Patent auf das Genom, alleridngs kann man ein Patent auf bestimmte Sequenzabschnitte bekopmmen!
Pharmafirmen haben meist Patente auf bestimmte Abschnitte mit denen sie forschen um neue Medikamente auf den Markt zu bringen..

Problem : Ein Patent läuft in der Regel nach 20 Jahren aus ! oft zu kurz um wirklich ein Medikamnet über längere Zeit zu testen !

Nun hat eine der angesagtesten Biofirma Maxygen eine gloreiche Idee gehabt !

Auf Musik Stücke gibt es ja quasi ein "Patent" auf 50 Jahre !!!

Was hat diese Firma nun gemacht -> ganz einfach, um den Abschnitt mit dem Sie letztendlich arbeiten für sich über längere Zeit zu sichern haben sie ein Programm geschrieben das den DNA Code , (oder auch Protein Code) in eine Musik Datei umwandelt um das Ganze als Musikstück zu sichern (geniale schweine :) )

Anbei eine Grafik wie das ganze bald funktionieren sollte...

Ich habe heute auch ein "DNA Song" von HIV (klingt etwas traurig :) und der Alkohol Dehydrogenase (verantwortlich für den Alkohol Abbau im Körper) , [klingt fröhlich ] angehört...

Die Noten werden immer gleich generiert sprich somit gibt es für jedes Protein oder Gen einen eigen Song ....

Ich werde sobalt ich das Sound File habe hier hochladen...


http://www.maxygen.com/ Firma mit der Idee

Übrigens haben diese Firmen die in diesem Bereich tätig sind das meiste Kapital ... die Firma Diversa hat soviel Knete das nichteinmal BASF die kaufen könnte ; die schenken denen nur ein Lächeln .......nur bekommen wir das nicht mit....

Firma Diversa versucht Genome von Lebewesen zu entschlüßeln und sammeln Organismen aus allen Teilen der Welt... Die Mitarbeiter dürfen in die schönsten entlegensten (quasi ein Aushänge Schild) Orte der Welt .... Bora Bora, Grönland, Galapagos, Amazonas usw... ... Grönland... arbeiten und Viecher sammeln :D

Ihr erstes Projekt war übrigens ein Protein das man genetisch verändert hat (von einem Bakterium welches sehr hitzebeständig war) um dieses in Pipelines einzubringen damit man eventuelle verstopfte Piplines einfach reinigen kann ...
das Protein hat einfach auch unter großer "Hitze" Öl Klumpen abbaun können....


Genial genial !!!!

Mal ein etwas weniger beeindruckendes Besipiel http://www.artic.edu/~pgena/rbdna.html

Hier handelt sichs um einen DNA Code ... dieser wiederholt sich ständig daher nicht so spannend ..

Wartet bis ich die Proteinsequenzen bekomme... die hören sich echt geil an ....
 
Zuletzt bearbeitet:
svag

svag

Flasche voll!!!
Mitglied seit
27 Apr 2005
Beiträge
53
Reaktionen
3
Ort
Wiesbaden
Hilfe, das kann man als Hintergrundmusik für einen Horrorfilm nehmen! :D
Auf was für Ideen man so kommt, unglaublich.
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Jo bei den ganzen Dingen gibts echt geile Lösungen , ideen ...

So kann man eben auch Patente umgehn ! !!!

Die Protein Musik ist aber wirklich besser klingt wie ambient lads dann up wenn ichs habe
 
G

Guest

Sammelaccount
Mitglied seit
4 Sep 2001
Beiträge
11.127
Reaktionen
894
Ja mach das unbedingt!!
 
Overhead

Overhead

iz picturizin'
Mitglied seit
12 Nov 2002
Beiträge
5.325
Reaktionen
205
Ort
Stuttgart/Strasbourg
Yo interessant.. zumal ich jedes Wort verstehe das du mir erzählst und natürlich den Background kenne ;)
Fed.
Hab sowas schonmal gehört, mit Immunoglobulinen.
(Gibt auch ähnliches mit Himmelsformationen)

Aber die Firma sollte dann ein "Patent" auf das Musikstück haben und nicht auf die Sequenzen.
Finde ich eh doof dass man sich sowas "sichern" kann.
Klar, fürs Geld ist es besser.
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Nicht alt alt Meister, das sind die ersten die es sich zu nutze gemchat haben um ein Patent so auf diese Art zu verlängern ; lies mal Text !!!!

Das man wiederholende Sequenzen oder sonstige Muster in Musik umwandeln kann is ja eh nix neues ! (das Prinzip ist shcon etwas länger bekannt aber noch nicht ausgereift und rcihtig public)

Ich kann Dir noch genug geniale Beispile aus der Genetik ziegen wo du Dich ans Goggle setzen kannst und suchen biste schwarz wirst weil du das nur in Puplikationen bzw. Patenten finden wirst, wofür du relativ viel zahlen mußt ...

Hier geht es um die Idee einen Patent Schutz zu umgehen !

zzz...

und da hat Maxygen mit einem Algorythmus und einem Programm den ersten Schritt getan


Außerdem ???????

Hier geht es auch nicht immer darum die neuesten Dinge mitzuteilen, sondern das man auch interessante Themen mal posted die informativ zum lesen sind ... Meister :rolleyes: :confused:

oder fällt Dir nix besonderes ein ...


@ Ovi ... Wie Ventor das menschliche Genom entschlüßelt hat hat s auch kein Patent gegeben obwohl er damals das Ganz als einziger geschafft hat ...
Wenn ers bekommen hätte hätte er ja das Recht (Patent) auf die Menschheit ;)
 
Zuletzt bearbeitet:
G

Gast5433

Guest
In irgendner alten c't ging mal das Editorial über ne Band, die ihr Geld damit verdient hat, Mucke aufzunehmen, die dann auf nen Chip in Druckerpatronen kam. Der Drucker checkte, obs die richtige Mucke war, und zack, kann man keine alternativen Patronen mehr anbieten, weil man die Mucke dafür kopieren müsste, was ja nicht erlaubt ist. Ich glaub es war Lexmark, ka...
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Oje ....... :D :( :mad:

Erstens sollte das hier nur eine Thread sein um einen kurezn Einblick in die Möglichkleiten geben wie heute teilweise verfahren werden muß um am Markt zu bestehn bleiben ...


So und jetzt zu dir Körnderlfresser und Holzschlapfenträger...

Erstens kann ich hier nicht in einem Thread (und schon gar nicht in einem DJ Forum) alles bis ins kleinste Detail schildern..

Mann kann auch nicht auf ein ganzes Gen ein Patent bekommen , das geht nicht ,sonderen viel mehr auf bestimmte Bereiche die aber aber alleine wenig Sinn machen ; einer Firma hingegen die mit diesen "Bereichen" schon länger arbeitet kann es sehr nützlich sein ...
Ohne Dir jetzt zu erklären welche Sequenzabschnitte man braucht um ein Gen erst Gen sein zu lassen und wie man ein Gen erkennt.....


Da fallen Horden von Biofirmenpersonal in "Drittweltländern" ein und versuchen auf jeden Furz und Feuerstein ein "Patent" zu bekommen.

Is doch mir schice egal !!! wenns für die zukunft was nützt ... und gerade diesen Ländern wird es zu Gute kommen weil man eventuell Medikament billiger herstellen kann ????

Wenn Du so ein "Gentechnik" Gegner bist dann hüte Dich in Zukunft Penicilin zudir zu nehmen [kleiner Tipp] nicht das Dir dann noch nen 5 Ohr wächst.

dann erklär mir mal bitte was die Natur bei der Evolution macht LOL !!
Base austauscht um zu optimieren ??? oder nicht ... LOL
Begriff aus der Biotechnologie -> direct Evolution - erkundige Dich !

Genau das macht man heute auch um z.B bestimmte Stoffe für die Pahrmafirmen zu produzieren damit man nicht Urwald abrohden muß um an das Teil heranzukommen um so Menschen das Leben zu retten ...-> Impfstoffe
Genau solche Leute wie Du haben das Wort Gentechnik in Verruf gebracht !


Es hat mal öfters umfragen gegebn auch in anderen Länderen ...

sind Sie für ein Atomfreies Deutschland -> glaub über 80 % ja sicher !
sind sie für ein Gen freies Österreich -> 80 % ja sicher !

na bitte !


Oder wußtest Du das mann Mais Gene kopieren kann um so mehr herzustellen..; das fällt nicht einmal annähernd unters sog.Gengesetz, das fressen wir alle - nur beim Änderen der Struktur gibts Probleme ; welche ich auch als Kritisch bezeichne aber das hat mit der Thematik was im Promille Bereich zu tun ... DAS IST KEIN SYNONYM FÜR GENTECHNIK !
:mad: :mad:



Es ist wirklich erstaunlich wie jedes mal das Wort Mais in Bezug auf die Gentechnik fällt LOL es ist nicht zu glauben ... :confused:


und .. ich habe diese Beispiel hier gebracht , warum, hab ich schon gesagt ..
aber bitte wenn sich einer nicht auskennt mit der Materie dann soll er das diskutieren gefälligst lassen...
 
Zuletzt bearbeitet:
  • Danke
Reaktionen: eno
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Sorry aber da hab ich keine Lust mehr weiter zu diskutieren ...seh schon nen bisschen Ahnung hast Du ja, aber trotzdem finde ich Deine Scheuklappen Sicht bei diesem Thema nicht angebracht !


und bei billigeren Medikament herstellen -> ja träum weiter
soll ich Dir jetzt auch noch Seitenweise Pharmawirkstoffe aufzählen die mittels Biotechnologie optimiert und verbessert worden sind , sprich auch die Produktion, weil man eventuell Promotorregionen verstärkt hat ?

Außerdem was soll das mit Gentechnik und Profitgier ? da gibt es genug andere Beispiele aus dem Leben wo das noch schlimmer zu Buche trägt .....

und übrigens Maker hin oder her , das wird aber dann schon zu speziell ... ich habe auch nie behauptet das es in der Gentechnik , (sowie in allen Bereichen des Lebens) Probleme gibt , die gibt es, aber da gibt es wirklich andere Dinge in anderen Sparten die brisanter sind.....

Immer gleich dieses "künstliche Aufstehn" wenn diese Wort erwähnt wird....

zzz...

Der Thread soll in eine ganz andere Richtung gehn :mad:

PROST MANN
 
Douche

Douche

Integer
Mitglied seit
31 Okt 2005
Beiträge
6
Reaktionen
0
Also, um mal die Stimmung hier ein wenig aufzuheitern...
...schaut euch "Doom - Der Film" an, da steckt DIE Lebensweisheit zur menschlichen Ethik drinne :-D ( und noch so einiges anderes :rolleyes: ).

@Vodox: In einem muss ich dir widersprechen, denn es ist Alles möglich. Ja, tatsächlich Alles. ( Stichwort: Moderne Physik / Chaostheorie )
Kommt halt nur auf die Zeit an ;)

@guggi: Dich kann ich auch ganz gut verstehen, bis auf eine Tatsache, in der du dich tatsächlich irrst bzw. einfach eine falsche Grundeinstellung hast ( Klar, ist meine Meinung, aber die ist Gut :D ).
Auf eine Aktion folgt eine Reaktion.
Wenn man ein Stein in ein klaren stillen See wirft, wird man am anderen Ufer die Wellen noch deutlich spüren.
Was ich damit sagen will, ist dass wir einfach nicht mehr mir nichts dir nichts ein anderes Land ausbeuten können, da wir ( Loverparade 1999 Motto,lol) alle in einem Boot sitzen.
Den Ländern, dritter Welt wird es ganz sicher nichts bringen, wenn Pharmakonzerne auf deren Kosten forschen oder ihre letzten Ressourcen plündern.
Stichwort : Bioparaterie in Brasilien oder Haupteinnahmequelle von einer ganzen Region ( so ein komischer Baum ) in Indien patentieren lassen und damit millionen Menschen NOCH ärmer machen.
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
hzm...

fidne das mal gut das man hier auch über so etwas diskutieren kann :)

Ich versteh auch Deinen Standpunkt sehr gut !

Ihr stellt das Ganze allerdings immer so hin, das Pharam Firmen , Biotechfirmen, Länder ausplündern ...schwarze Schafe gibt es überall ! dagegen wehre ich mich auch...
Da machen aber diese Firmen einen sehr kleinen Teil aus ..

Wenn ich mich in Labor stelle , (zur Zeit Forschung an der CYP3A4) dann sicherlich mit dem Hintergedanken die Medizin , die ja von uns abhängig ist, weiterzubringen -> im positiven Sinne versteht sich.
Auch meine Diplomarbeit hat mit dieser Ganzen Sache zu tun. Du wirst in Zukunft höchstwahrscheinlich davon hören , weil es sich um eine Datenbank handelt die gerade den Mediziniern und der Biotechnologie von großem Nutzen sein wird...Datenbank für Muteine, Mutanten ; die gibt es bis dato nicht !

Wenn Du hier Deinen Standpunkt vertritts dann finde ich das auch gut so , Du befaßt Dich mit der Materie und hast auch Ahnung ! Allerdings geht mir der Hut hoch bei der allgemeinen Aussage :

Gentechnick ist schlecht ! (welche Du nicht getätigt hast,es anfangs aber so raus gekommen ist )

Natürlich gibt es wie in jeder Branche, Sparten ,Richtungen die nicht vertretbar sind , keine Frage ....!

erkläre mal "Otto" Normalverbraucher das Du mit Strahlung zu tun hast ! Da gibt es sicherlich einige die plötzlich ne Diskussion anfangen über die Atombombe (krass ausgedrückt)

und genau das meine ich , Gentechnik -> Synonym für Mais, Tiere mit 6 Köpfen usw.

Zum Thmea:
Was würdest Du machen wenn Du eine verbesserte Möglich keit erfinden würdest Schilddrüsenfunktionen zu unteruschen , du die aber nicht "sichern" kannst weil es scheinbar überall Schlupflöcher gibt .....Solltest eine Möglichkeit gefunden haben würdest Du sicherlich auch von dieser Gebrauch machen ....
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Wer Geld hat, lebt einfach länger

Ja , leider ist das traurige Wahrheit ...

Aber hier kann man ja Schritte für die Zukunft setzen , und es stimmt schon das man mittels optimirerungs Schritte auch auf Gentischer Basis billiger produzieren kann...

Wer das allerdings wohin um wieviel verkauft, ist ja wieder ein anderes Thema mit dem die Forscher ansich, nicht mehr viel zu tun haben (mehr oder weniger)

Da ist das Ganze System daran Schuld , Wirtschaft , Industrie , Kapitalismus usw..

Die lieben Amerikaner haben auch vor glaube ich 20 Jahren Afrika ausgebeutet und Kaffe dort für 4 Millionen erwirtschaftet ! Verkauft haben sie es dann für 8 Millionen

Vor 5 Jahren glaube ich haben sie ungefähr 10 Millionen erwirtschaftet und für 80 verkauft !!!

(die Zahlen weiß ich jetzt nicht ob die stimmen aber die Größenordnungen schon )

Diese Gradwanderung zwischen diesem Anspruch und dem Profit muß allerdings
von der ganzen menschlichen Gesellschaft getragen werden.
Sprich, da müßten alle Staaten mitmachen.
Leider auch unrealistisch. Und das ist daß traurige daran

stimmt, aber soweit werden wir nie kommen ......

den auch in der Medizin herrscht Profitgier bis in die Unendlichkeit ...
 
_jim.N

_jim.N

dAjim (labil rec)
Mitglied seit
20 Mai 2005
Beiträge
292
Reaktionen
21
Ort
Erlangen
guggi, hier gehts doch nicht um Gentechnologie sondern um die Patentierungstechnik. Und aus welchem Grund sollte man die Sequenzen durch den Umweg über die Musik länger patentieren wollen ausser aus purer Profitgier. Also ich versteh diese Euphorie in dem Zusammenhang auch nicht.
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
erstens hab ich nicht eine Diskussion über Gentechnik angefangen .. sonderen lediglich eine Methode geschildert mit der man in Zukunft auf bestimmte Abschnitte einer DNA sequenz für sich (Firmen) länger schützen kann um so intensive Forschung zu betreiben und sicherlich auch zu verkaufen !

Was habt ihr denn immer mit dieser Profitgier , wo lebt ihr überhaupt ..

Ich glaub ich spinne schon langsam ..
Ihr hört Patent und Gentechnik und schon ist alles schlecht ???

Ist doch klar das auch diese Firmen Kohle machen wollen oder ?

Wollt ihr nicht Kohle machen ...

Ich schau mal an wenn einer von euch ne tolle Idee hat und die dannach patentieren lassen will ?

Oh welche Schreck so ein Geldgieriger , Profit orientierter Unmensch ?

Möcht mal den Typen sehn der ein Patent auf Kleiderbügel gehabt hat ... ist der nun Profitgierig und schuld daran wenns in der dritten Wild Kinderarbeit gibt wo die Kleinen Kleiderbügel herstellen müssen ? (spitz ausgedrückt)

Wenn eine Firma, egal mit was die zu tun hat ein Patent entwickelt um so am Markt bestehn zu bleiben bzw. sich weiterzuentwickeln, dann ist das einfach schlecht ? äähhhhh

Oder hat das , wie in diesem Fall etwas mit dem Wort Gen zu tun weil sich keiner richtig auskennt bzw. ihr die Dinger nicht sehn könnt ?

LOL

In diesem Falle hilfts einigen Firmen über lange Zeit Kapital zu bekommen um so weiter Forschung zu betreiben --> am Forschungsgeld mangelt es leider überall... aber soetwas will ja nicht in die Köpfe rein :mad:

Aber okay, da baun diese schice Amerikaner nen Aquarium für 300 Millionen US Dollar und keiner regt sich auf , wohl aber wenns um Froschung geht und man würde dort das Geld rein buttern :mad: :mad:

Oder was glaubt ihr wie man Krebsforschung betreibt .... mit Sachen die man aus der Apotheke kauft und im Becher zusammen mixt ??
Puder, Staubzucker , Tannenzapfen und Co. ?????

Nein aber mann kann aus der Natur lernen in dem man Organismen untersucht die eventuell Krebszellen abtöten können...
Oh Gott bewahre wenn ich nach Afrika reise so ein Organismus dort finde und damit Krebsforschung(Gentechnik) betreibe , ich bestehle ja Afrikaner ?!!!

und wenn hier eine Frima für sau teures Geld Medikamente verkauft so hat das meistens was mit der Wirtschaft allgemein zu tun, denn diese Firmen müssen auch für sau teures Geld Laborequipment kaufen...

Beschuldigt doch die Elektro Industrie , warum sind high tech geräte so teuer ?
Wenn die billig produzieren können dann wäre alles kein Problem , oder ?

-> Biochemie , Gentechnik -> die Basis der heutigen Medizin und sonst nichts

zzz...

Ist ja fast schon so das ich das Ganze mit Software vergleichen kann -> Frima hat geile Idee -> verkauft software sauteuer (was dennen auch gebührt )

so eine gemeine Firma , so teuer ist das Teil , aber !-> Software ist halt einfacher zu klaun ! :mad:
 
_jim.N

_jim.N

dAjim (labil rec)
Mitglied seit
20 Mai 2005
Beiträge
292
Reaktionen
21
Ort
Erlangen
guggi schrieb:
Ist ja fast schon so das ich das Ganze mit Software vergleichen kann -> Frima hat geile Idee -> verkauft software sauteuer (was dennen auch gebührt )

so eine gemeine Firma , so teuer ist das Teil , aber !-> Software ist halt einfacher zu klaun ! :mad:

nö, is ja auch Profitgier. Hat hier niemand bezweifelt.
Ich finds nur komisch da gerade Du der anscheinend ne Ahnung in dem Bereich hat so ne Lobeshymne hier loslässt. In jedem Bereich gibts Patente. Die sind selten für die Allgemeinheit gut sondern erstmal für den Einzelnen. Die 20 Jahre sind schon lang genug. 50 Jahre in dem Bereich sind ne Ewigkeit.

So, und jetzt fängst Du wieder gleich die Diskussion über Gentechnik an..
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Ist das denn so ein Problem mit den Patenten ...

Bei Musikstücken gehts ja , oder ?

Ist ja auch klar ...

und ehrlich wenn ich auf die Intelligenz und die Gerissenheit andere einen Neid hab, dann selber schuld ...

Ich finde solche Ideen , Patente und Erfindungen immer genial sofern sie etwas sinnvolles bewirken ...

um auf die Musik zurückzukommen ...

Wenn du morgen einen Hit schriebst , was machst Du dann wenn Dir gesagt wird , Dein Song ist der Hit ! wir pressen es sofort auf Vinyl bzw. CD ..

stimmt die Mehrheit würde sagen NEIN um Gottes Willen, nur kein Geld daran verdienen bzw. Urheberrechte will ich auch nicht . ich will ja kein Ausbeuter sein. (für 50 Jahre !)
Sollen sich die anderen den Hit nehmen und daran verdienen , meine Arbeit die ich reingesteckt habe ist mir egal.....

20 Jahre ein Patent genug ? meistens, weil mann alleine schon z.B für die Produktion (oder was auch immer, genug erfahrung gesammelt hat und somit auch einen großen Vorsprung genießen darf) nur wenn es ausläuft dann wirds immer ein Kampf [ich kenne das glaube mir] man muß meistens schnell was neues in die Welt setzen oder verändern um wieder am Markt bestehn zu können....

meist sind 20 Jahre genug ; aber selten in der Forschung (schon gar nicht in der Biochemie), hier sind oft Langzeitstudien gefragt ! (dafür wird Geld benötigt , was wiederum durch Patente, Ideen reinkommt)


In der Musik gehts, aber wehe es geht um Forschung !
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
Guggi mal ehrlich, ohne Dir zu Nahe treten zu wollen, aber so wie Du über deinen Alkoholkonsum redest, hast Du definitiv das Säufergen in Dir

ROFL

hehe

also bitte ohne das Du mich wirklich kennst, gleich so ne These aufzustellen zzz..

zu Deiner Info , mag das den einen oder anderen jetzt erstauen, ich liebe es einwenig zu übertreiben und besonders wenns um Kinderein geht.

LOL ich glaub sogar das ich weniger sauf wie Du, weil ich unter der Woche absolut keinen Alkohl trinke ! höchtens am Wochenende wie jeder andere auch; auch mal unter der Woche wenn am nächsten Tag ein Feiertag ist oder ich frei hab dann gehört das einfach auch zum Geniesen dazu ein gepflegtes Bierchen zu trinken ! Ich trinke nicht mal was zum Essen !

LOOOOL -> wie genau du die Threads studierst hehe




Genscreening wird im Labor immer gemacht sonst ist es nicht effizient -> ist was ganz anderes , als wie du das darstellst..

Also entschuldige bitte ich glaube das Du dich mit der Materie doch nicht so auskennst ...

Die Beispiele die Du hier erläuterst sind auch gefährlich, und wirklich die Spitze des Eisberges .... aber der Größte Teil der unter Wasser liegt sprich von dem die Leute keine Ahnung haben ist die Gentechnik die uns auch viel Nutzen bringt ......

hmz heute erst wieder ne Puplikation gelesen wo wir Methan eventuell mittels eine Proteinen in Methanol umwandeln können (noch ein weiter weg dazu , leider); ich geh hier nicht näher darauf ein was das für die Umwelt , für die Industrie usw. für positive Effekte haben wird ...

Ja bei der Weiterentwicklung der Computerchips regt sich keiner auf und die die sich aufregen, brauchen genauso den Fortschritt der mit der Elektronik gemacht wird ....

Sorry aber wenn du alles so betrachtest wie du es geschildert hast dann hätten wir nichts , beschuldige dann bitte die Erfindung der Dampfmaschine !

Gentechnik bei Einstellungstest... also bitte das sind Vergleiche die von irgendwo herkommen und verzerren das ganze Bild hier ...
Da könntest ja auch gleich anfangen mit Chemischen Waffen die nur auf bestimmte Bevölkerungsgruppe gerichtet sind
:confused: :confused:

Also bitte wenn ich von Gentechnik rede dann in einem Niveau mit dem man was anfangen kann und nicht von solch wahnnwitzigen Vorstellungen. Vielleicht kommen ja auch bald Roboter die wir vom echten Menschen nicht mehr unterscheiden können usw... (beschuldige elektronik Industire)

Weißt du eigentlich wieviel Forschung gemacht wird um Proteine zu konstruieren die Schadstoffe abbaun ! das wären 100000 Beispiele ]

Den Chinesen würde es jetze helfen wenn mann Benzol "spalten" könnte , mit hoher Aktivität ...
Du erwähnst genau die Bespiele die die Gentechnik in Verruf gebracht haben und die kannste an der Hand abzählen (Spitze des Eisberges) und diese sind auch negativ zu kritisieren !


Solche Beispiele sind auch der Masse einfacher begreiflich zu machen....

welchen Locos hat das denn auf ner Genkarte , also bitte :rolleyes: :D
 
Zuletzt bearbeitet:
eno

eno

Gernot Hassknecht des DJF
Mitglied seit
5 Jan 2005
Beiträge
1.932
Reaktionen
94
Sag mal guggi, wann bekommst du denn nun die Mucke zu der DNA? Ich will Montag ein bisschen beim Bio-Lehrer rumschleimem, Schaden kann's net.
 
diefenwald

diefenwald

klangspion
Mitglied seit
20 Jul 2004
Beiträge
2.220
Reaktionen
231
jo habs noch nicht bekommen ........ schau mal ob ich det beschleunigen kann :)
 
 
Oben